EST 1199875 is a singleton


Sequence

>1199875 (1 EST) Length=572 ATATGAACATATGTTTTTTTCTTTCTCTTCATTATATTTTTTTTGTGAATAATGGAATACAAATATTATGATAAGAAGAT GGATAAGTGCATAAGTTTTAATGAAGCTTATGATTTAAATAATGATGAGAAGAAGGTTGGCACAAGTTATGAAGATTTCC TTATGAATAGTTCATCATGTATGAATGATGAATATATGAAGTTAAATATTTTTACTGTTATAAAAAATGAAATAATAAAT GTATTGTCAGTTATAAAAAAGCATGAATATAACAAAAATTTAGATTCTAGTATTGTAGACGCTTTATTTATATTATATAA TAATATAAATAATTTAAATAACAATTTAAAGGAAGAAATAGATATACATGATTATAATAATAAGTTAGATATATATCACA TTGCTCCCTTTTTAAATATCATAAGAAATAATAATATCTTTTATAAAATTAAGTTAATTGCATTACATTCGNTAGATCAT ATATTAAAATATAATAGTAGTTATTTTAATGATAAATGTACTAATGAACATATAAATCGAAAACAAATATCTTATTTATG TGATGATTATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199875: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998752320117AA5498650938m3gmbPfHB3.1, G. Roman Reddy


Date: 20:50:49 on Wed 22 Nov 117.