EST 1199876 is a singleton


Sequence

>1199876 (1 EST) Length=419 TTATTATTATAATATTCTTTTTGCGTTATGGAAATATTTTTTGGGGGTATTTTAATATGTTTTTCTTTTTCATTATTTTT AGAGATATTTTCATCTATATTATAGTCCATAATATTTTTGTCGTTAATATTGTATATATGTTGAGAAGGTTCTTTTTGAT TGTGTTCATTTATAAGATGATTGATGTTTGAATCTTCCTTTTGATCATCTTGTTTTATAATATCTACATTTATATCATTT ATAGAAGTAATATCTTCTTTTTTATCATAATTGTTTTTCCTATTTTTTATGTTTGGCATATAATTGTGTGATCCAAAACT GCGGCTAATTTTTATTTCTGTATTTTCAAAACTATTATGTTTTTCAAGTAGTTCACCAGTCTCTATTTTTTCATCATACA TATTTATTNNATTATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199876: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998762320118AA5498660939m3gmbPfHB3.1, G. Roman Reddy


Date: 11:7:14 on Tue 21 Nov 117.