EST 1199878 is a singleton


Sequence

>1199878 (1 EST) Length=518 TATATATATATTTTAATAACATTTAAGTTATAAACTTCTTACAATGTCATATTTTTATGAAAAAATTATATTTTATTTTT TCTTTTTATGCATGCTATATTTTCAACCATTATTTTAATTTTTGTATAATATAATATAACGCACAAATTTAGGTTATTTT ACTTTAATAAAATTATTATGTGATATACATATTATCCAAATAACTAAAGAAATAAGAAAGAAAAAAAAAAAAAATTCGGG AAATTATAGATATATTGGAAATTCGTTATTTATTGTAAATCTTGAAAATATTATTTCATCATTATATAATATTATAAAAA GGCATATATTAAGGAATTCTAATTAAATGAAAAAAATATGTATATTTATTATTACATTTGGAATTAATTTTGTTTTATAA ATTTTAAACATTACTATCCTAATTATAAAGTAATTTTTTTTCTATTAAAAAAAAAAAAAAAATTAANCAGATATTTTATA TATTGAACTAATTATATACTATCCGCAAATACTATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1199878: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998782320120AA5498680941m3gmbPfHB3.1, G. Roman Reddy


Date: 16:17:16 on Fri 17 Nov 117.