EST 1199879 is a singleton


Sequence

>1199879 (1 EST) Length=548 ATATTTATATTTATTTATTTATTCATTTATGTTTATATAATTTCTATTCATTCAAGTTTGGTTTTTTTTAGGTCCATATC ATTCGTATTATCAAGAGCGTCTTGTTTTCTTTTATTTGACTTTTCATCTTTGTTTACACCTTCTGTTTCTTTTGTATCTA TATCATAATCCTCTTTATCTAAATCTTCTTTATCAAGATCCTCCATATCTTCATCTTCTAAATCATCATCTAATTCGTCA TCTTCGTCATCATCTTCATTATCATTGGGTACAAATTCTTCATCTTCATCATCTTCATCTTTAAAGTCAGCTTCATAGAA ATTTTTTAAAGTATTATCTTCTTCATATTCTTCTTCTTCTTCTTCATCTGAACTTAAAACTTCCATACCTTCTTTATTAT AACAATCGATAATTTTGACATTTGGTAAAAATTCAAATAATTCTTTTCTGTAATTTGGATTATCTGCAAATGGATTAAAT TGTACTCCTAAACGAACTAAATTTTTAATTCTTTCAAAGTTTCAAAATCATTTATATTTTTAAAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1199879: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998792320121AA5498690942m3gmbPfHB3.1, G. Roman Reddy


Date: 13:31:39 on Wed 22 Nov 117.