EST 1199880 is a singleton


Sequence

>1199880 (1 EST) Length=419 TTTTAATATTCTCCCCTTTGTATTACTAAATATATTTTAATTCTATTTCATTTTTTTTTTTTTATTTCATTTTTTTTTTT TTTATTTCATTTTTTTTTTTTATTTTATTTCATTTTTTTTTTTTATTTTATTTCATTTTTTTTTTTTTTTTTATTTCATT TTTTTTTTTTTTTTATTTCATTTTTTTTTTTTTTTATTTCATTTTTTTTTTTAGGTTAANCCCGGNGATGTACAAGGATT TGGGATAGGNGCTCAAGGGGATAAGATGGTCCCCCNNCCAAGATATTGTTGGGTTAACGGCATACCATTAAGTGACTTTA CAAAAAAAGGGGCCATTACCGAAAAAGAAATAAATCAAATTGTTGAAAAGACAAGAAACACGGGCTTTGAATTATTAGAA TTGTTACCAGAAGGCTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1199880: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998802320122AA5498700943m3gmbPfHB3.1, G. Roman Reddy


Date: 21:2:30 on Sun 19 Nov 117.