EST 1199882 is a singleton


Sequence

>1199882 (1 EST) Length=472 ATATATTCATATTTGTTTATTTTTTTTATTTGTTAATGTGTTATATGATATACCGTTGAGCATTCACTTATACATTCATA AAACTTTGACATGTGAAATTTGGTTAGAGCCATATTTAGATGTAAATTAATTTCTAGTTTTCTTTGTTCCTTTTCTTCCT CATTTGTATCTGGAAAACTATAATCTAATTGTATTAATCCTTTACGAAAATAAACACAAGCAAGTTTATAATTTTTTTCA TAAAAGGCTTTTTTTCCTTCTTCATTAAATAAATTTGAAGCATTAATTTTTTCTTTTGTTGATTTTTCATATAATTGTCT TTCTTTTGAATGGTCATGAGAACATGGGTTTTTATTATTTATAAAATCATGTTTATGTTCTTCTCTATGTCTTTCTTCTN NNNCTTCATTCTCAATATCATTTATACATTCTTCAAACTTACTATAATCTAGTTCATATTTTGATGGTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199882: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998822320124AA5498720945m3gmbPfHB3.1, G. Roman Reddy


Date: 3:2:19 on Tue 21 Nov 117.