EST 1199883 is a singleton


Sequence

>1199883 (1 EST) Length=549 GTTAAAAATGAAAGTATTTAAAGACGTTTTTACAAATGATGAAGTATGTTCCGATTCTTATGTTCAACAAGATCCATTTG AAGTACCAGAATTTAGAGAAATAGCTTTTGAAGTAAAATCAAATAAAAGAATAAAGGGAAATGAAGATTATGGTATTGCT GATAATAGCGAAGATGCTGTAGAAGGTATGGGAGCAGATGTTGAACATGTTATTGATATTGTTGATTCCTTTCAATTGAC CTCCACTGCTTTTAGTAAAAAAGAATATAGTGCTTATATTAAAAATTATATGCAAAAGGTTGCCAAATATTTAGAAGAGA AAAAACCAGATCGTGTTGAAATTTTTAAAACTAAAGCCCAACCATTTATTAAACACATTTTAACAAACTTTGACGATTTT GAATTTTATATGGGAGAATCACTTGATATGGAAGCAGGTATTATTTATTCTTATTATAAAGGAGAAGAAATAACACCACG TTTTGTTTATATATCTGATGGACTTTTTGAAGAAAAATATTAAATTGTTTATAACACACACAAAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199883: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998832320125AA5498730946m3gmbPfHB3.1, G. Roman Reddy


Date: 14:34:43 on Tue 21 Nov 117.