EST 1199885 is a singleton


Sequence

>1199885 (1 EST) Length=505 TGTAGTACATACACAAAAGAAACCATCAAGAATAACATAAGTTAATCATATCTATTCCTTTAGTAGTTTTATATATTCGA GTTTTTTCTTCATTTTCTTTTTTCGTAGATAACGTAAAATCAAATAAATAATTACCATAACTAAAATTATGACTACTATT ACAATAACAGAAGCAATTATTGCAGTAGTTAAACTACTAGTTGCACTGGCTCCCTCTTCCAATACACCTGCTTCAGTAAT TTTAGCTATATCTGCAGCATTTTCTGCTATTCCTGATACTCGCTGGGATAATGCACTTTCCCGACTACGTGATACGAAAT GGCAAAATGGTTCAGTTTTAGCAACATTACCAACACACTTTGTNGTATTAACTTTTTCAACAAATGAAAAATACGTCGTT TTTTCAGCATAATTTGTATGATTAATGAAACTTTGTATTTGTGAAACCTTAATTAATCGAGATAAGCCAGGAAAGTCTGT TAAACATTGAATCCCATATTTAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1199885: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998852320127AA5498750948m3gmbPfHB3.1, G. Roman Reddy


Date: 8:25:8 on Thu 23 Nov 117.