EST 1199887 is a singleton


Sequence

>1199887 (1 EST) Length=479 AATATTTCTTTTTCTAACTCATTCAAAAAAAAAATGAAAACATTATATATTTTATAAGATATTATTTTAAATATTTATAC ACATCAATCTGATAAATAAGTATATGTCCCTATTTTTTTTTTTTTTTTTTATTTTTTTTTTTTTTTATTTTTTTTTTTTT TTTATTTTATTTTTTTTTTTTTTTCTTTTATTCTGCTTNAAAAAAGTGTTTTATCTTTTTTTGNNGNTTAAAGCAATGAA TAATCCAACAATTCAGAAAACAATCGATCAATTTTTCAAAGTAAAAAGAAAAAGTAGTATCCTTAGTGGGGAGATAGAAA AAAAAAGAAAGAAAGTAATTTTAGAAGAAGTAGAAGAAAAATCGTTGGAAGGTAGTTTAAAAGAAGAAAATGTAAACATT TGNNGACGAAAAAACTTATGAATAATGATGAGGATATAGAAAAGATGGGTNCAATAAGTAATATTAGTATGAGTACTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1199887: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998872320129AA5498770950m3gmbPfHB3.1, G. Roman Reddy


Date: 2:49:26 on Thu 23 Nov 117.