EST 1199888 is a singleton


Sequence

>1199888 (1 EST) Length=350 ATATGCATACATNTCATAATTATGAACAAAATATTCTATGACCTTAGAAATTGTACAAGAAAAAATGTTACATTTTATTT TATAATTTTTGAAGTATATATATTTATAATTGTTTATGTGTGGAGAATCCATAAAAGGATAATCAAAAAATTAGAACATA AAAAAAATATTTTTTAATTTATTTATAAAATATTTTTAAAAAAAATATATACAGGATACATTTTTGGAAATTTACGGCCC CAAGAAATTATGATTAAGTTTCCACATATATAGAGGAATATTTTAATATTAATTAAAATAAAAAAAAAAAACCTACTATT AGTGTTATGCAAATTCTTTAACATGATACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199888: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998882320130AA5498780951m3gmbPfHB3.1, G. Roman Reddy


Date: 21:11:51 on Fri 24 Nov 117.