EST 1199891 is a singleton


Sequence

>1199891 (1 EST) Length=557 TATTTTATTATTTTTTTTGAATATACCCAAATTGGACAAAAATAATATACTCAAAATTGTAAAAGACAATGTAGTTTTTC CACTCATATTTTTTCCAGTCAATAAAATAAAATTTTTCTTTTTTAAAAAAAAATCATATTTAATTAAATTATGTTTTATT ATATTATAAGGTTTGGCTCCTATTATATATGTTATTGAATCGTTAACGTAATTTTTTTCTTTATACATTTTTTTTATTTC TTCTGCTGAATCTTTGTCTATGTTTTCTAAAATTTTCTTTTCATCACATGGAGATAATTTTACAAATTCATTGCTATTCT TTTGATCATTTATAAAATAATTCGAAGGATCATTTTTATTTACATTCTTTGTTAATGTGTACTCTTTTATTTCGNCTTTG TCATCGNACACTTTTTTTTGTATATAAGCTAACTTATCGNCGATATTGTTGAAGCTCATATTTTCATATGACAAATGTAG GTGTTTACATATTGGNAGGGACCATCCTTTCTTGAGACTGTTAATGGTATGGTTGTATAGAGCCTACAAAAAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199891: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998912320133AA5498810954m3gmbPfHB3.1, G. Roman Reddy


Date: 15:13:50 on Wed 22 Nov 117.