EST 1199893 is a singleton


Sequence

>1199893 (1 EST) Length=601 TAATATATAAAATATTATAATATAAAAATTAATTTATTTTCCCTATTCTAGGGAGAACATGAATAAGAAAGTAAAAAAAA AAAAAAATAAGAATAAATAAATAAATGGATGTAAATAAAAATGAATCTAAAGGACAAAACTATAAAAAGAAAAACTCTGA TATTATTTTCTACACACCCAAATCAAATTTGGGGATTGACAGTTTACAAAAAACTATTGCCTTTAATAATTTATTTAAAT ATGTTAATAAAAATATTAAAAAAGATGAAATAAAAAATGATGAAATAAAAAATTACGAAATAAATAATGATGAAATAAAA AATTACGAAATAAATAATGATGAAATAAAAAATTACGAAATAAATAATGATGAAATAAAAAATTACGAAATAAATAATGA TGAAATAAAAAATTACGAAATAAATAATGATGACATAAAAAGTTATGAAATTAATAATGATAAAATAAAAAGATATGAAA TTAATAATGATAAAATAAAAAGATATGAAATTAATAATGATAAAATAAAAAGATATGAAATTAATAATGATAAAATTAAG TGTGATAAAATAAAAAATGATCATCTTAAAAATGTCCCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1199893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998932320135AA5498830956m3gmbPfHB3.1, G. Roman Reddy


Date: 16:17:58 on Sun 19 Nov 117.