EST 1199899 is a singleton


Sequence

>1199899 (1 EST) Length=565 TTAAGAGAATCNTAATAATAATAATAAGAAAAAAGATCCAGAGACATTTAAGAAAAGGGACGATAGTTTTTTGATATATA AAGAAAGCATAAAGAGTTTCAATAATAATCATTTGTCATCTTGCGAAGAAAAAAAAGATAATATAAATAATAATAAATGT AATATAAATTCTTTTGTGTATACATCTGAATTTGAAGAGCTATATAATAAAGATAAAGATTTTTTAGGAGATATAAATAA TACCTATAATAAACAAAGAAAAGAAAATTCGTTTTATGAAAACAGTAGTAACCTTTCTCAAAACACTGAAGAGTATAGTA GTAATAATTTTGTAGCTTCTCATAATATAAATATCGAGGAGAAAAATTTGAATAAGAAGAAAAAATCAACAAAGTATAAA AAAAAAAATAAGGAACTTAATAACGTATATATAAAGAATAAAAGTGAATTGTATAAGGTTCATAAATTATATAATAAGAG TAATCAGCAATATATAAAAGAACAGGAAAAAGAAATNCAAGAAAAGGAAGAAGTAGACTTAGACGTTGAAGGAGAAGAAA CAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199899: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11998992320141AA5498890962m3gmbPfHB3.1, G. Roman Reddy


Date: 4:29:35 on Mon 20 Nov 117.