EST 1199900 is a singleton


Sequence

>1199900 (1 EST) Length=659 TTTGACGGTCAACTCAATATTGTTCTACATTACGAGATACCAAAAGCTTTATTATAATATAACTCTACAAAGTTGAACAT AGGCTGAGTCTCTATGCCTTGAATGGAGCACTGGATTGGATACCCGGGAAACCGGCGCTTCCATTTATAAGAAGTTAAAT TACTGGAAGCGTCTGTAAGGTTACAACACAAGTCACTGATAATTCTGATGAATATTTCAAGTTACTGACATCTGCCCGGC ATCAATGATAAACGGCGGCTGTATTTTAAACGGTCCTAAGGTAGCAAAATTCCTTGTCGGGTAATCTCCGTCCTGCATGA ACGGTGTAACGACTTCCCCATTGTCGCTAGTGTGAGACTCCTAATAAATAGAATTATCCATGAATATGTGGAATCATACG GCCCGACGGTAAGACCCTGAGCACCTTAACTTCCCTAAAAGTTCTTATGTGTTGGCATGGTTACGAGATTTAAGGATGAA ACCTTCCTGATCGACTCGTGAGGTAAAAGAAACAGTCGGTGCGAAGTCGTAACATGGTAGTTGACAGTGAACTTGTAGCT GAACCAAAAATGGCTGCTGGAAGTAGAAATCGTTATTAAGCGTCAGGAAGTCCTGGACGTTGAATCCAATAGCATTGATT AAAAGACATCGATATACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1199900: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999002320142AA5498900963m3gmbPfHB3.1, G. Roman Reddy


Date: 22:56:35 on Wed 22 Nov 117.