EST 1199906 is a singleton


Sequence

>1199906 (1 EST) Length=373 TTTATGTATATATGTATATATTCAACTTATAGTTTTAAAATTTATCATGGCCTTATCTATATCAAAGGGACCATAAAATC TTTTTCTATGTACTACAATATTACATCAAACATAGAAAGCATAGACTTTTCTTTATAAAGAACTTTTTCATATTTTAAAA AATAAAATTAAACATTTGCAAGATTCTTTAAAAGATTTATCTATTAATTTAAGTACTTTATCATAATAAATGAAGAAAAC ATAATGAAAATATGTNACTCACTTAGCATACATATATCTTATTACTTTCAAAATATAGGATATTTGAATATCCTCATATT ATCTTCATTTTCTATACACAAAATAGCTAGCCAGCTAGCCACAATCAATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1199906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999062320148AA5498960969m3gmbPfHB3.1, G. Roman Reddy


Date: 13:19:53 on Thu 23 Nov 117.