EST 1199908 is a singleton


Sequence

>1199908 (1 EST) Length=395 CTTTTTGACATTATTTAATTGTGACGATTTAAAATTTTCACGATGAATAAGATGGCTAGCACTCATAACGAGATTATTCC GCGACTTGGTTTTGAAGAAATGAGGAACGAAATGAACAAATACGGTGTGGAAATAAATCAGAGTACGTTAAAAAACCCGA GCACAGAAGATATACAAGGGATATATAGTTTATGTATAAAATATATATTAAATAAAGATATTCAGAATATACGAATAGAA GAGTATACAGGAGATTTAAAAAGTTCTTTACCCACAGTTGATGGTTTACAGATATTACCAAATGAAGGTAAGAATCATTT ACAAGCTATTGGTAATTTAAGATTTCTTCGACATTGTGAAAAGATTAATAAGATATTAAATTTAGATAATATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1199908: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999082320150AA5498980971m3gmbPfHB3.1, G. Roman Reddy


Date: 8:19:39 on Wed 22 Nov 117.