EST 1199919 is a singleton


Sequence

>1199919 (1 EST) Length=531 TTATTCTTTGTAGTTTTGAATACTTGCTCCTCATCATCTGTTCCACTCCTAACACTCCTAAATGTATTTATATTTCTATT CACACCTGTACTTGATTCATCATTCCAACAAATATTGAAATCATTCGGATTATCAAAATTTCCAAAATATTTATTTTCAT TCTTTTTATTATTAAAAGCTTCTGAATAATTAACAAAATTGTTATATTCTTTAACTGGAAATATATTATTATCACCAAAT GAATTATTTATAAAATCATTCAATTTATTGTTAAACAAATTACACGATGGAAATTTTATAAATTTTTTATTTTTAGAAGT TCCTTTATTACATAATATTTCATTCTCATAATTATTATTACCAAATTTTATATCATACAAATTTAATGGTTCTGTATTAC AATTTTGAGTATACATATCTCTTTTACATTCAACAGTATTATCTTTAAAATCATTCATGTTATAATCCTCATGAACCACA TTATTAACCATTCTATTTAACTTTTCATTATAATCAAATTCATTGAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199919: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999192320161AA5499090982m3gmbPfHB3.1, G. Roman Reddy


Date: 9:35:40 on Thu 23 Nov 117.