EST 1199923 is a singleton


Sequence

>1199923 (1 EST) Length=362 TGTTTGTGTGTGTGTATTTTATATTGTAAATTATAATAATTTTTTTTTTTTTTTTTTTTTTATTTTTACCTTTGGATATC GTTGGCTGAAATGTGTTAATATTAATGTTTTACATTGTACTTCCAAACCTATATAAAAAATAATAAAAAAAAAAATTAAT AAGACACTTATTTTTCATGAAATTATTATTTTATATATTGAATAATTTTTTTCCATTTTTACTTATATCCATAGCTTCTT TAGTAGTAGAGTGTTTTTTATTAATTGCTTCTCCTAATAATTCATCATCAAAGGTAGCTGTAAAGATGTATTATTCAAAC GTGTAATGTTAGTAAATATATTAAATATAAACATAAATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199923: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999232320165AA5499130986m3gmbPfHB3.1, G. Roman Reddy


Date: 0:29:55 on Fri 24 Nov 117.