EST 1199947 is a singleton


Sequence

>1199947 (1 EST) Length=243 GCGTATTTGTTTCTGTCAAGTTTAATAATAAAGAAGGTTCTATTTTTTCATTTTTCTTTTCATTATATAAAGAGGTTCTC TTTAATGACTTACAGCTGGCGTTTATTGAAGACATCATATATTTAACCTTTTCATTGTAATCATTATTTTTAATAATATT TGATGATTTATTATATATTGAAGGTTCATTTTGTTCAATATATTTTTCCTTATCACTACCAAATTCGTGGGTTACTATTT TAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1199947: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999472320189AA5499371014m3gmbPfHB3.1, G. Roman Reddy


Date: 6:15:38 on Thu 23 Nov 117.