EST 1199967 is a singleton


Sequence

>1199967 (1 EST) Length=510 ATATGAACTACGGAAGACATCAATTTGCAAATATTGGATAAAAGGGATTTGTGCTAATGTCGAATGTAATTTCGCCCATG GGGAACACGAACTAAAATATACATTCGGTGTATATAAAACAACTATATGCAAACATTGGAAAAAAAACGGTATGTGTTCT AGTGGTATTCATTGTAGACATGCACATGGGGAAAGTGAATTACAACCAAAAAATTTACCTTTACATTTATTAAAAAAAAA AAATAATTTGAAAAATAAAAATCAAACAAAATCTTTTCATACAAATAAAGAACTTACCATAAATGAATATAATGATCGTT CTGCAAATAATAGAAATGTTGAACATATGTATAAGAATAAGGTAGATCCTTTAAAAAATAATAACAATAATAATGATAAT ATTTATTATTATGGAAATGAGGAGAATCAAAAAGATGTGAATATTTTTAGAATGGACCCATTTTACAACAATATTTTTGA TAGTCGAAATCTTATGGATAAACCCCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199967: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999672320209AA5499571034m3gmbPfHB3.1, G. Roman Reddy


Date: 2:38:29 on Sat 25 Nov 117.