EST 1199973 is a singleton


Sequence

>1199973 (1 EST) Length=408 TATTACTCACAACAGTACTTCGAATAAAAATTCCTACACTCATTTTTCTGTATGTTACATATTTGTGACTCAACATTTTT TCTTTTTATTATATTCGATTTGTTCCCTATATATATTTTTATATTGTTCTTGTATATGTAAAAATTTATAACCATATTGG TCCTCCTCTGGTTGATGTAAATTTGGTAGCAATAACATTAGCAAAAACTAAAGATGTAATTGCTGATAATTTAATTAAAA TGTTTAAAGATGGACCCGAAGTATCTTTTAATGGATCTCCTACAGTATCACCAATAACTGAGTTTTTGTGAGCATTTGAT CCCTTGCAATGTTCTTTTCCTAAAGCACCTGATTCAATATATTTTTTTGCGTTACCCCTTGCTCCNCCAGAATTGGTTGA TGAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199973: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999732320215AA5499631040m3gmbPfHB3.1, G. Roman Reddy


Date: 4:29:54 on Wed 22 Nov 117.