EST 1199975 is a singleton


Sequence

>1199975 (1 EST) Length=303 ATTTATATGTAAACTTTCTATTCGTGTTCCCATCAAATCTGCATAATAAAAACATCCCAACATAATACATTTTTTTTTTC TTTTTTGGTATTATATGAAAACAATATTTGGATTGGCTTTCACAAGGTTCCGTTTTTACTTGTTCAAATTTATTATCGAA GGAAAAAGTAAAACCTAGAAAAATATTATCGTATTTANTAATATATATATCTGAACAAGCTCCTCGTATATCATCTTGTA TACTACCANCATGAATATATGTTAATTGTNAAGAAGANAGACTACCAAAAGATGAAGGTACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1199975: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999752320217AA5499651042m3gmbPfHB3.1, G. Roman Reddy


Date: 8:56:53 on Mon 20 Nov 117.