EST 1199979 is a singleton


Sequence

>1199979 (1 EST) Length=352 AAATATATATATATATGTGCCACAGATTAACCAAGTATCTTAAAAAAATGAATACATATATAAATATTTAGAAATGAAAA TACAATACATGATAATAATATATTTTATCATTTTGATCTGCGACAANTTCTTAAATGTAAATGCTACNCGAAAAAAGAGT TNANGGAACGATATTAATAAAGGTAGGCTGGCATAATAGAAATGAATAAATATATATATATATATATATATATATATATA TATGTGTGTGTTTTTTTTTTTTTATTAAANAATTTGCTTTGTTTATTTNTTTAATAATTAATCTTTATCCCACCNNGTCT GTNTTTGTTTGCTTGAAAGCNCGCACTCACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1199979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999792320221AA5499691046m3gmbPfHB3.1, G. Roman Reddy


Date: 21:36:1 on Fri 24 Nov 117.