EST 1199983 is a singleton


Sequence

>1199983 (1 EST) Length=647 TATATATATGTATATGTTGAATTGTTTAGTTTGTTCGGATCCATTTTTTAAAATAAAAAAGAAGTGCCAAAAGAGAAGCA AGAGGGGAAAAACAACAAAAAAAAAATAATAAAAATAATCTGGAAAACATAAGGGAAAAAAAAAAAAGTAATAATAAAAA TAATCTGGAAAACATAAGGGGGAAAAAAAAAAAATAATAATAAAAATAATCTGGAAAACATAAGGGGAAAAAAAAATTTG GAAAGGTTATGTACTTATTTTTTAAAATAAATAAGTATGAAAGTGAATTGATGAAAAATAAAATAAACATGAAAATATAG ACTTACAACAAGATTTAAATGATGAACCTTTAGAACCCTTTCCTACACAAATACATAAAGATTATAAAGAAGAAAATTTA ATAAATGAAGAAGATTCAGAACCATTTCCCAGACAAGAGCATAAAAAGGTAGACAATCATAATGAAGAAAAAAACGTATT TCATGAAAATGGTTCTGCAAATGGTAATCAACAAAGTTTGAAACTTCAATCATTCGATGAACATTTAAAAGATGAAAAAA TAGAAAATGAACCACTTGTTCATGAAAATTTATCCATACCAAATGATCCAATAGAACAAATATTAAATCAACCTGAACAA GAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999832320225AA5499731050m3gmbPfHB3.1, G. Roman Reddy


Date: 1:56:48 on Sat 18 Nov 117.