EST 1199984 is a singleton


Sequence

>1199984 (1 EST) Length=669 TTATATATGTCTTTTTGTTCATCTTCATTATTAGGAACATTCATATAATCATAATCTTCAACAATCTGAACATTATATAT ATTATCATACATATTTATTTCTTCGTTTAATTTATCTTTTATATCTTCTAATATAGAAACTTCACTGCTTTTCATATTAT TACATGAATTGTTCAGCTCACTATTCGAGCATATCATAGCATTCGGACACATCGTCGTAGCTGTCGTTGCTGTAGTAATT GTAGTAACTGTCGTGGCACTTGTGGTAGTCATCTCATTATTATCATTATTATTACTTTCCATATGATGAAAACTACTATT ATTTATATTATTCTCATTTATATGACATAAATTATATATACCATCACTANNCTTTTCTTTATCTACCTCTGGTATTTCAT TAGTATCATGTATATTACAAGTATCTTTTAAATTATCTGAACTCATTTTTGGTTCATTTAAACTATCCACATGACAACCA GCAATACTACTACTATTATTATTATTGTTATTATTATTATTATTGTTATTATTATCATCATTTTTATTGTTATCATCATT TTTATTATTATCATCATTTTTATTATTATCATCATAAATATTATTACTTACATTACTTTGTACAGGCTCATTACTACTAT CCAACGTCTTTTCATTATTTACATCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1199984: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999842320226AA5499741051m3gmbPfHB3.1, G. Roman Reddy


Date: 13:46:55 on Mon 20 Nov 117.