EST 1199986 is a singleton


Sequence

>1199986 (1 EST) Length=527 CATAAATTTTTAAACAGCACACATACTATCTTCACTACATGTAAAAAAAAATAATTTATTTTTAAACTTCCCCATATCTA TATCCCATACTCTAGCATTATGACCTGTTAATATTTTTATGCATGTATAATAATATAAAGAGGGTTCATTCATTTGATAT GTATTTTATATCCTTTATTTTTTTTTTTAATATATTCTTCATTCTTCATCCTATACCATACACGTCCTTCTCTATCATCA GAAACTGAGCAGATATATTTTGTGCTTTTAAAAAATTTAACTTTAAAAATGATACCTCTATGTCCACATAATTCTTCGAA ATGTTTTATTGGTATAATAATTTTATTACTATTTATGTTATTATTTTTATTTGTTTGAGCACACCAATATTTTGTAATAT CTTTTTTATTAATCTTAAATGACCACAATAATATTTTATTAAATGGAGTACCTCCTACGACATAAATGTTGTAACATTTT TTTTGATGCTTTATGAATATATCAGAACTATATAATAAATGTATACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1199986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999862320228AA5499761055m3gmbPfHB3.1, G. Roman Reddy


Date: 12:16:31 on Fri 17 Nov 117.