EST 1199987 is a singleton


Sequence

>1199987 (1 EST) Length=410 AGGATATTTATAATAATAAGGAAAATATTAAGATGACGTTTAATGTTACTAATCGTTTTACTGTTTTAGGATGCGATTGG GATAATATTTCGAGTGTTGATATATTTTATTTATTTGAATCTTATTACAATTTTGAAAAACGGAAAAAGAAAAATATTGA TTATAGTAAAAGTAGAGCAGTTAAAAAGGTTACTATATACACATCAAAATATGGTGAAAAAAAATTGAAATCTGAAGAAG AACATGGACCAGTAATTAATTCTGATCTTTTAAAAAAAAAATATAATAAGGATGAAAATGCCTTGTATAGAAAAAATAAT TTATTAGATTATATAAAGGATGAAGATGAAAACAGTGAGAATGGTGACAATGATCAGGAAGAAGAAAATGAAGACCCTGT TGAAGTACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199987: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999872320229AA5499771056m3gmbPfHB3.1, G. Roman Reddy


Date: 5:44:12 on Sun 19 Nov 117.