EST 1199988 is a singleton


Sequence

>1199988 (1 EST) Length=637 GTTTTATTTGTAGGGTATGATACATTACCCAGGAAATACAAAAAGAATTTAAAAAACTTATATCTGGTTCATAGTGGTTT TTTATCAAAAACTCTTTTGACCATTGTAACTCCATTTATATCCCCAAAATTTTGGAAGAAGGTGGAATATATAGAAAAGT TAGAAGATTTATTTTTAAAATTAAATATAAAAGCATCAAAATATTTAAAATACTTTCCTTATATTGTTCAAAGAAATGAA GAAGTTATGTTAGGTGGTCAACCTATATCTCCATTTGGAGCTGACTTAGAAATATTATGTCAAAGATTTGGTAAAAAATA TTTACATTTTAAACATATACCATCAATTCTTATAGATTTCTTAACCCATTTAAAAAAACCAGAAATAATTAACACGAAAG ATTTATTTAACTTACAAGCACATGCTGCAACATTATATGGTATTGTTGGAGATATAGAATATGGAGAACCAACAACTGAT TTTAATAATATCCCTTCTCTTGTTTGTTCATTCAAACTTTTTTTAAATACACAAAAGCATGGATTGTTAGGAAAAGATGC TTTTTCAAGATTACATTATTTAAAAAGTACTTCAGCTTCAGATAAAGTTATTAAATTGAACTTATCAAAACTATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1199988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999882320230AA5499781057m3gmbPfHB3.1, G. Roman Reddy


Date: 15:3:54 on Sun 19 Nov 117.