EST 1199989 is a singleton


Sequence

>1199989 (1 EST) Length=650 TATATATATATACCTTCTAGATATATTTTATAACCTTCCATTTGATTTCTCACAAAAGATATGAATGTTGTAACATTCTT GGAATTGATTTCACAGACTATTATAAATACATACATACATATGTATGTGTGTATGTATGTATGTATGTATATGTGTATAT ATTTATATTAGTAGAACCAAAAAAAGAACAAATAAATAATTCAATTATTATACCCTTTTTGATTTGTTCGTCTTTGTATT TTAATAAGGAAAAATATTTATCTACTTTCTTTTTATATGTTTCCTTTTCTTTAAGAGCCAAGTTAGTAACATCCATCATG TTATATTGAAATGAAGATACGTAGGTATGCTCAGGAAAATCATTTTTATAATCAATATATTGATCAAAATTTAAAGCATT ATTTTTGGTTAATGTATCTGTAGAATATTTCTTTATATTTTGTAAAAAGTGCTATAAAACGAAAAGGAAAAGATATATAT ATATATATATAAATATACGTATGTATGTATGTATGTATATATGTATGTAATTTTTCATTTATTTTATATTATGTTATATG AATGTATATAGAACCATTTCTTTATATATGTTTTAATATATGAATTGTACCTTTTCTTCATTGTTTCGTTTATTAGATAA TTCGTGTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1199989: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11999892320231AA5499791058m3gmbPfHB3.1, G. Roman Reddy


Date: 12:26:59 on Fri 17 Nov 117.