EST 1200003 is a singleton


Sequence

>1200003 (1 EST) Length=565 TTATCTTATAGAACGATGAAATAATATTTAATAATCTAATTTCAAAATTCGTAATTATTTTAAATATAAATGGAATTAAT GTATCTTCAGAATAACGAATATCTTAAATTGTTGCTACATGTCATAATTTATATATTCATATTCACATTCAATTGTTTCA TGTGATTAAACAAAAAAAAAAAAGTTTCTAATCAGAAAATTATAATATTTTCTTTCTACCTCTTTAATTTTGAATTATAA AATTATTATATTCATAATATATTAATTTCTGATTTCTTAAGATTCATTTTGGTTTTTGTCTTTTTCATATACTATTATAT TATAAAATATGTCTTCCAATTATTTATCTTTCAAGTGGATATTACTAACTTTTTTTTATGCCACTCTATTCTATAAACGT TATTTCAAAATAAAGAATGAAAAATTTATTTCGCCTAAATTAACGTGTCAGTTATCTGGAAAGAAAAAATTCTATAACTG CTATATTTATATATTTTATGATATTTATAGAATATACTATTAAGCAATGTTTCTTTAATTTCTGGATCACACTTATATAA GAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200003: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000032320245AA5499931072m3gmbPfHB3.1, G. Roman Reddy


Date: 21:14:7 on Sun 19 Nov 117.