EST 1200007 is a singleton


Sequence

>1200007 (1 EST) Length=356 TATATATTATAAATTGGTATTATATATATGTCATACACAATTTCCAAAACGTTGGTTTTGCACATTTGTAAATAATTTAC AACACAGAAATATGTTGTATTATTACTATATCGTTAGATATTATTGAGAAAAATGAAAAAAATAAAAAAAAAATAAACCA AAAATAACCATAATAATTTATTGTGTTGATTTAAAATTAAATTTCATTAAAAATTAAAAATTAGAAAAAATTATAAAAAA TGCAGAATGTTTTGATAAATTATTTTAATATTAATTTTTTTACGTTTTTGTTTTTTTTTTTTTTGTAATAAATAAAATGG CAAATGTGGATCCACTATAAAAAAAAAAATATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1200007: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000072320249AA5499971076m3gmbPfHB3.1, G. Roman Reddy


Date: 4:31:57 on Wed 22 Nov 117.