EST 1200011 is a singleton


Sequence

>1200011 (1 EST) Length=421 TACATTCTTTAGTAATAATATCATCTTCAAAATCATTGTGTAATGAGGTTTTCAAATAATTTTTTAAACATTCTTTTGAA TATTTATGTCCACATGACAAAGTATATGTATCTTCTATATCACATTCTAAAAATAAGATGGGACAAATAAATTTTTCTTG TTTACAATTATGTACAAATTGTTCTTTTTTTTGTTTTATCATGGGTTCATCTATATTATTATTATTATTATTATTTAATA TATCTTCTTCCTTCAAATGAGATAACTTTAATTTTGTTAATACTTTTTTTGAATTATTAAACCAATTTTCTAATAAATCA TTTGAATTAAAATTATATGCTTTTAGAAAATGATAAGCATAATCATATTGTACATTAATTAAATTCATAATTTCTAAAAT GGCTAGTTCCATTTTTTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200011: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000112320253AA5500011080m3gmbPfHB3.1, G. Roman Reddy


Date: 12:33:53 on Sun 19 Nov 117.