EST 1200016 is a singleton


Sequence

>1200016 (1 EST) Length=618 TTATTTAAGAATTACTCTTCTTGTAACCAAGCAAATGGAAACTTCCCCAGTTAGCTTGGACAAGGAAATATGGGAATATA GATATATAGGAAAAGAAAAGTATATGTATTAAATTATTGATTAGATATAATTTTTGTGAAAAGAAATTGTAAGAATTAAG TATGAATAAAAGTCTGAGAACAAAAAATTTATAAAAGAAAAACAATAATGTTGATAGAGTATGTATTTTGACAAGTTTAT CTGTTTTAATATTTTTGAATTCTCCAATAAAAGCATATTTTTTTTTAAAAAAGGTATATATATAATCACTTTTAAAATAT AAAATTGTAAAGAGTAAAAATAAAAAATTTACAGAATTATAGCTTATTAATTTTGAAATATTAGATGATTTGTTAAAAAA AGGTATACTACTAAGATATTCATGTATAGAACTATTGAAATATTTATCTTTTAAATATGTTGTTGTTGTATTATAATAAT TTTTTAATTTCCCTCTATATACAGACATATCATCTTTCAATCTGTTAAATATTATTATAGAATATTTCTTTGCATAATGA TATTTATGTACAACTATTTCTTGGGTTCTATTTTTAAATTTATCAAAATCTTTTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200016: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000162320258AA5500061085m3gmbPfHB3.1, G. Roman Reddy


Date: 4:33:3 on Thu 23 Nov 117.