EST 1200030 is a singleton


Sequence

>1200030 (1 EST) Length=577 GATAAATGCAATAGTAATGTGTATAATAATAAAATACAAACTAATGTGACAAAAAAAAAAAAAAAGGAAGAAAATTATTT TTCTTTTTTCATAAAATATAAAAATAAGAATGATATAGAAATGTTCATTAATTGTCATCCATTTTCAATTAATAGCAGTT ACAAAATATTCTTAAATTTTTTAAAAAACTTTTTTAAAATAATAATTGATGACTTTGATACATTTTTTTTTTTTTTAAGT TTATTCTATTTAGAATACTTTTTGATATATTGCCATTTTTTTGAAATAATTTATTTTATTCATTTGTCCAACCATGAAAA AAATTACAACAATGTGGACACAAATAATATAAATGTGAATAGTTTGGACACAAATAATATAAATGTGAATAGTTTGGACA CAAATAATATAAATTTGAATAGTTTGGACACAAATAATATAAATTTGAATAATATAGATATGAATAATATGTGTGATCTT CAAAAAAAGTATAACTCAAAAAATATATATAAAGATACCAAGTTTACTTCAGTGAATGTATCTGCTAACAATGTTGCTAC GACATATGATGAATGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200030: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000302320272AA5500201099m3gmbPfHB3.1, G. Roman Reddy


Date: 13:37:58 on Thu 23 Nov 117.