EST 1200036 is a singleton


Sequence

>1200036 (1 EST) Length=607 ATTATTATTGTGATAATTATTTATGTTTGTATTTGTATTGGTTATGGTATTATTATATTCATTTGTGTTTTTGTCAAGAT TTGAATATTTTGTAAAAAGGCGTACACTATTAAATATTAATGATTCATTAAAAAATAGATGGACAATATATCCTCTATAT ATTCCTTGATTTATTATATCATTATTTTTTTTAGCTAAATCATAATCACAGAAATTATTAATATTTAAACATGGGATTCC TAGATCATAATTACCAAAATATGATAACCATAATATTCCTTTATATTTTTTAATAAAAGATGCATATAAGATATCATATA TAAATTTATGTTTTTGATTTTTGTTTTGAACATTGAATAAATTAAATAATGGTATATTTGATATTCGTGAAAAATTCAAA TCTTCTTCTACTCTATGATAATTTTCAAAAAATAGATTTAGAGATAAATTAAAAATGTCATTTTGATAATTTAATCTTGG AACATTTTGATATTTATTTGTATTATCAAATTTATAAAAATAACATGGGAAATATTTATTGGTAGCCCACCAACCTAATT TTTTTTTATCAATAGTTGATGATACATAAAAGATATATTTTTGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200036: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000362320278AA5500261105m3gmbPfHB3.1, G. Roman Reddy


Date: 23:6:32 on Fri 24 Nov 117.