EST 1200037 is a singleton


Sequence

>1200037 (1 EST) Length=593 TTGTTATTCATATTATTCATATTGTTCATATTGTTCATACTATTCATATTGTTCATATTGTTCATACTATTCATACTATT CATATTGTTCATATTGTTCATATTATTGTTCATATTATTGTTCATATTGTTCATATTATTGTTCATATTGTTCATATTGT TCATATTGTTCATATTATTCACATTATTCACATTATTCACATTATTCACATTATTCACATTATGCACATTATTCATATTA TTATTTTTGCTGTTTGCATATTGTCCCATCGGCGCAAATCTATTTACCGTATGATTACTATGTTCCCTCATATGTTCAGA ATTGTTCACATTGTTTCTTGGGCCCCCCTTGTTCATATTATTCATAGGTGTATTCATTGCACTACCCAAATTATTATTAT TATTATTATTATTGTTATCAACTTGTTGATTCATTTTTATATTTGTATTCATCAATTTTTTATTTTCGTTATTTCTATTA TCTGTAGGTATATTATTTTCACCTTGATTATTTGTTAAGGGTGGTGCTGGAGGAGGTGGTACAGGATTTTGTGTACCTCT NTTTAAAAAACATGTAAATCCAACCATAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000372320279AA5500271106m3gmbPfHB3.1, G. Roman Reddy


Date: 16:15:57 on Tue 21 Nov 117.