EST 1200050 is a singleton


Sequence

>1200050 (1 EST) Length=338 ATATATATATGTGCACATAAATATATTAATTTATTTCTCATTTTATATTACATTTTTGTCAACTAGCAAATTAAACCAGT CACAGTCAGCTGGCTCTTTATGAGAAAAGCTTCGAGGAATTTCCAGTTTATNTAATGTTCTTCTGCTTATTCCAAAAGTT TTTAACGTTTCTATAGTCACTCGTATATATGATGGAGCATTTATTAAATACTACACAAAAAAAAAAAAAAAAAAAAAAAA ATATATACATATATATATATATATAACTTTTTTATTCGTNCATATATATATATATATATATATATATATATATATAATAT TAGCTATTTTCACNTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1200050: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000502320292AA5500401124m3gmbPfHB3.1, G. Roman Reddy


Date: 10:27:45 on Mon 20 Nov 117.