EST 1200052 is a singleton


Sequence

>1200052 (1 EST) Length=506 TATATTTATTTATTTATTTATTTATTTATATTTATGTTGCTTTATATTGTGTGATAATTTTTACCCTTTCTTGATAATCC TCCTGATTGATCTCATCATTCTGTTGAACGTATTGATTTTTTTCCTTTTCGTAATAATACTTGATCAAATTAATTATATT TTCCTTGGTATAATTACACATGATAACATGATAATGTGTGTTTATTTTATTAAGATTGATTTTGTTAATGTCGTTTAAAA AAATATATATCCTATTTAAATTATTCTGTTTCAATATTGTATATATATTTTGATCAACTCCTTGAAAAATCAAATAGCAA TTCTCATTATTAAATTTCTTAAGTTTGTTAATAAAATTATCTATATGGTTATTTTTCATAATATATTTTTTTTTGTTTTT TTCATCATCACATATTTTATCACAAATGTTAATGTGATCCGTACTATAGGATGATAATTTAATTTTATAAAAATATTCAT ATTTTATGTAAACAAAATTTTTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200052: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000522320294AA5500421126m3gmbPfHB3.1, G. Roman Reddy


Date: 18:33:38 on Sat 18 Nov 117.