EST 1200055 is a singleton


Sequence

>1200055 (1 EST) Length=168 ATATTTCATATATTATTTGTTTGTTCTTGGTTTGTTCGACTGTCTGTTCAACTGTCATATTTCATATTATTTCANATGAA GGGTTAACAAAAAAAATAAAGTACAATATTAAAATATTAAGAAATTAAAATTTTTTTAAAATTAAAATATAAAAATAATG TATCATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200055: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000552320297AA5500451132m3gmbPfHB3.1, G. Roman Reddy


Date: 1:12:35 on Mon 20 Nov 117.