EST 1200056 is a singleton


Sequence

>1200056 (1 EST) Length=421 TATATAATTTATCTTGCTTCCTATTTCTATAGATTTGTTTTTTTTCTAAACCCACCATTAATCAGATGATAAAACCATGG TGCTCGATTTACTTCATATAAATTTTTCTCATCAAAAGATTTGGGATCTTCATAGAAAAACAATATTTCTTCTTCCTCAT TCAAATTATTATTACTTGACATTTTTATTTATATGATACTTATATATATATATATATGATCATATATTTTTTTTTAAAAC CTTTAATGCTCAAGTCAAATTTTCAATTTCATATATGCTTATAATAATATCAAATGTTCATGTTTAAATTATTATAAAAT AGTTTGTACAATACACATGAATGTATCTCTTTTTTATTTTCTCCTATAAATAAAAAAAATAAATAAATAAAAATAAAATA AAATAAAATAGAAATAATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200056: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000562320298AA5500461133m3gmbPfHB3.1, G. Roman Reddy


Date: 8:14:46 on Thu 23 Nov 117.