EST 1200058 is a singleton


Sequence

>1200058 (1 EST) Length=670 CAATTGTTTAATTGTTTATCTATTAATTATGTTCATGTTTCTTTTTGTTTAACAAACAAGTTAACGTCACATGCTAATAT ATATGACTTAATATTAAAAGAATTATTATTTCTAAGTATATAAAAGTACCCTGAATTCCCCCAGTTGGTACCCCAACTAT TTAATACTTTCCAATATTTTATAATAACATTATTGTTATTATTAATAATATTATTATCACCATTATCATTATTATCACCA TTATCATTATTATCACCATTATCATTATTATCACCATTATCATTATTATTATCACCATTATCTTTATTATCACCATTATC TTTATTATCACCATTATCTTTATTATCACCATTATTATTACTATCACCATTATTATTACTATCACCATTATCCTTATTAT TTTCCTTCCATGTTGTTAAAATATGTTCCATGGTTTCCTTAGAGAGTTTATTTTTTTTAACAAAATTGGGTAAAGTATCT TCTCCCCATCCTACTATTACTACAGCATGATCCACCTTATTCCATATATAAGCATGTTTTTAGTTCCATCATACATTTTA ATGAAATTTCCTAATATTATTCCTTTTTTATATCCTATGAATTCACTTGAAGGTTCTATGGCTGCTGCTACTGGTCCATT GTAATAAATATATTTTTTTAATAATTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200058: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000582320300AA5500481138m3gmbPfHB3.1, G. Roman Reddy


Date: 5:47:16 on Sun 19 Nov 117.