EST 1200061 is a singleton


Sequence

>1200061 (1 EST) Length=535 AGTTTCTTCTTTCTCATTTTTTAATATATCATCTGTTCCGTTCTTATCATTAATATATTCTTCATCTTCATCTTCATAAC TGTTATCAGAATCAAATTGTTCATAAAAATAATTTTTACTTAAGCACATATTTTTATTTTTATCTGAAGATTTTTCATTT GGATGATATAATTTGAGTGCACATGAACATTTATCTACCTTGTGTATTTTTGTATCATCATTCTTTTCTTTAATCCTATC TTTATAAGCATTTACCACATTTTTTACATTACTTAAATTATTTACATCATTTACATCATTTATATTATTTACATTTTGCA CATTTTTATTTCTTTTTTTAAAAAAATACAACGGATAAGATGTTAATAAAAATATGGTTAAACCCAAACATATTTCACGA ACAAAAATATGCGAATCTCCTATATCATTTTCATACACATATTCTTGTAAATACAAAATTAATATTTTAGTTATTTTGTT TATATTTAATTTGTACTCAAGTATATCACTATGCATATCTCCATTTTCCTTTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200061: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000612320303AA5500511141m3gmbPfHB3.1, G. Roman Reddy


Date: 20:45:36 on Wed 22 Nov 117.