EST 1200062 is a singleton


Sequence

>1200062 (1 EST) Length=550 GTTTTGTTCAGGAGGGTAAAACATTGATTAACTTAAGACTTTATTAAATTACACACTTCATTAAAGTACACACATATATA CATGCGTATATATATGTATGTGTGTGTATATACATTTTTATATATATGCTATAAATTCTAGGACATCCCATAAAATATAA AAAACAAAGATATAAGTTCTAAACTAGTAAAAGAAAAAAATAGAATAAGAAAAAATAAAACATGAAATGTAATCCAAAAA AGTAAAGAAGGAATATAAAAGAATGTAGAAAAGGCGGAACAATAGAATGCATAAAATAAAATGGTAGAAATGGAATCCAA ATTAAATATATATATAATAATGTGAATTTACTTAATGCTGCTGTATCGTACATTTAAAAATGGGTAAGATGATAAATTTT ATGTCATGTGTATTTTACTACAGTTAAAATTTAAATATATGTGCCAAAGTTTATGTTTTATATCTGAAAATTTTAATGTA ATTTTGATTTGGATAACCAACTATAAATGAGTTGGAAGAAAATACTGGGTTTTCTGAGCTAACAGAGTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200062: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000622320304AA5500521142m3gmbPfHB3.1, G. Roman Reddy


Date: 1:36:22 on Sat 18 Nov 117.