EST 1200066 is a singleton


Sequence

>1200066 (1 EST) Length=469 TATTTTTTTTTTATTTTTATTTTTTTTATAAACTTTTTAAAGATTGAAAAAAAATTTAAAAATAAAAAGAGCTATAAGTA CAACAACAACAAAAGATATAACAATAAAAAACATATAGGTATATGCATTTTTCCTCTCTTCTGCTACTAACATATGTCTT ATCATCGGACTCTTTTCAAATTCATATAATTCAATTTCAGTATTACGTGGTATTTGATTAATTCCTGTATGGAGTAAAGA AGTTAAAATGAATGGAAAAAACTTCAATGATAAAAATGAATAATTCGTTTCCTTATCATTATTATTTANTTTTTTATTTT TTTCTTCGTCTTCTTTAATGTTTGTTGTTTTATTTGATTCCTCTCGTATATATATATTCTTTTTTTTAACACATTTGTAT AACTTTTGTTTTTATTTTTTTCACTTGAAAAAGAACTAGCACTAAAACTANTATTAATTATTGTTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200066: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000662320308AA5500561146m3gmbPfHB3.1, G. Roman Reddy


Date: 4:15:47 on Wed 22 Nov 117.