EST 1200069 is a singleton


Sequence

>1200069 (1 EST) Length=492 GGAACATATTATAATCATATACCTTATAAAAAAAAATGGCAATTCTTATTAAGTTTTTATATGGAATTTATGAAATAGTT ATGGCAATGAGAAGAAAAAATGAGCAATTTGTTGCATACACATACTATATATTAGATATATATAATATTTATATATTATT AAACTAAAAGTCAAAAATTAATTGTGAACGTTATAACATGGAAGAAGTGATTTTTTCAATAAAATGAAAATACATGTATA TGAGTATATTTATTAATATATAGAATAAAAATAGCGTTAAAAGTAAACCATCTTATTTTATTTCATTTTATATTATTTTA TTTCATTTATTTTTTTTTTTTTTAAATATTGAAAAATAAATATAGGCATTTTAACAAATGCATTTGTATACCAACATATT ATACACACCTTTATATTTTTTTTACATATGACTTATTTAAAAAAAAAAAAAAATTCTGTTGAAAAGGATGAATAAAGAAT ATTAATTTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200069: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000692320311AA5500591150m3gmbPfHB3.1, G. Roman Reddy


Date: 19:24:53 on Fri 24 Nov 117.