EST 1200074 is a singleton


Sequence

>1200074 (1 EST) Length=697 GTATATAATTACGATGAAGTTCTTCGTCTTCTCCTCTTATTATTAAACGAACCTGAGATCCAATCTAGGACCTTTTCTAA AACTTTTTCATTTCCTGGTTCCATTGTTAATAAATGATCCATATCATAAATTGTATAAAGTTCTTTTTTATCATTATCCA ATTGATCATAAAATGTTACAACACCTCCATAATAACATGCACAATCGTGAATGGAATGAACAAATAATATAGGAATATCT TTTGGAATATATTGTATATCTTTTCGTAAATTTGTTATCGATCTTAAAATTTGATGACCAAATTTAAAGGTTATCCATTT TTTTGATCTATGTTTATCAAAATTAATAATATCATTAACAAATGGGAACATTTCAAAATTAAAATTTTGATTAATTCTAC ATTTTGGAAAAATATAAGATATAAACTTTGAAAAAGGAACTAAGAAATATTTATATTTCATTGAAGCTTTTGATGATAAC TCCTCAAGACAAATCATACCAGATAAGGATATACATCCTTTTATATTAAGATTTTTATAATCACCTGACTTTCCTAATAA TTCTAATGTTCTTAAAACAACATTACCACCCATGGATAAACCCATAATATATATAGGAATTTTATCTTTTTTTAAAGCTT TCATATCTGTATTTTTTTCTCTTATAGCTCTTAAATATTTATTTCTTTCATAATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200074: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000742320316AA5500641158m3gmbPfHB3.1, G. Roman Reddy


Date: 0:53:16 on Wed 22 Nov 117.