EST 1200082 is a singleton


Sequence

>1200082 (1 EST) Length=459 ACTTGAAGAAAAGAATGAAAGAACGTGGATTCATTTCTATATTATTATGTAATACAACTCCATATTTCGATTTATCACCA TCACATCTGTTATTATTATCACATCTGTTATTATTATCACATCTGTTATTATTATCACATCTTTCGTTTGAATTCCCTAC ACGACGCATATTAAATAAATAATTCATACGCTCAAAGAACAAATTATTTTTCAAAGAAATACCCGTTTTTTCCAAAAACA ACTGCTCCGCATTATTAAAATTATACATATGTTTAAATATATTCGTATTACTAAAACATTTGTAGAACTTTAAATTATCA TACATCTTGGATATAAAATCTTGTTTTTTGTTTATATGTTTACTTTTTACATCCTTCCTATTTCTTAAAATGTTTTTTGT CCTTCTAATTTTAAGCATCCTTTTTGATTCTTCTCCTCTTCTGTAATTTCTATATAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200082: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000822320324AA5500721167m3gmbPfHB3.1, G. Roman Reddy


Date: 19:16:23 on Thu 23 Nov 117.