EST 1200087 is a singleton


Sequence

>1200087 (1 EST) Length=540 TTTCTGTTTCATTTATTTCTGCTTTTATCTTTATTCCTTCTCTTTTTTTTGTTTTACTTTCTTCAGTTTTTTTATTATGG TTTTCATGGTTCCTTTTCCAGCTTCCTGAGTTGAATGTTTAGTTCATNTATTTTCAGTCTTCCTTGTTTTCTAATACATT TAAAGTTGTAAATTTTCATCCAAGTACTGCTACATTCCATAATTTAGATATGTAGGGTTCCAGTTGTTCGTTTCTAAACA GGTTGTAATTTCGGTTTTGAATTTCTATTTAATCCATGAGTTATTTAAAAAACTGTTTTAAATTTCCAAATAGATGGTTT TGTGGTGGTGTTACTTATTTTTGGTTCTTGGCCATCTGTTTGTTAATAATGTCTACATTTACTGTGTTAATTCTTCTATG TAGCTTTAACATTTTTGACTTCTTTTTGAAATTTATTGAGATTCTGTTTATGGCCTAATAAAGACTGAAATTGTTGATAA ATATATTTTTAAAGGATGTATATTTTCTGGGTACAAATATACATATACATGCAGACGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200087: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000872320329AA5500771173m3gmbPfHB3.1, G. Roman Reddy


Date: 7:0:52 on Mon 20 Nov 117.