EST 1200089 is a singleton


Sequence

>1200089 (1 EST) Length=395 AGAATATATATATATATATAAATATATATATATTATAGGCATATTATATCGCTGCGGGTACAATAAATATAAATGTAAAC ATAAAATAAATATGTATATGTATGTATTTATATATTTTATTTTATTATTTTTTTTTTTCTTGTGAGTATGTATAAAATTA TTTATTATGTTACCTGTCAGGTGAATTTCTATAACGTCTTCTCTCACTATTTGATACACTTGTTGATTTTCTTACTCTAT CATATCTCTTTTTCCTTTTACTGTCATCTCTTGATGGTCCCCTTTCATTATCACTACTTCTTGCGTTTCTTTTATAATAA TCATTTCTTCTATAATATTTATTATCAATCGATCTTCTATCATAATTCCTATAATCATTACGTGGACGCCTACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200089: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000892320331AA5500791175m3gmbPfHB3.1, G. Roman Reddy


Date: 1:43:40 on Sun 19 Nov 117.