EST 1200091 is a singleton


Sequence

>1200091 (1 EST) Length=568 AAAATATTCTAATGTTATTATTCTAATATCTATAAATATATCTTTAATTTTATTTTTATATATATATATTTTATCAATAT ATGTTTAATTGTAATGCACTAAGGAATGAAAAATATGGATAATAATAATTTTCATATTTTAATATACTTTGAAATATAAA TTGATAAAATGACATCACATTTAAATTATTGTATTGTTCTAAATTAATATAGAAAGGTGTTTGTCGAAAGTTATTTTGTT TTATATTATTAAATTCATATTTTTTTTCAAAATCAATATTATAATTATTGAGTGGGCATAGTTTTACAATGAAATATCTA TGAATAACAGAATATTTCATTTTATATTTATTATAAAGATCGAATGGATTATTTTCTTCTTTTCCTTTTAATGTCCATTT ATTATTTATATAAGTATTTATAATCATTTCGATATGATTTTGAAAGTGTACTAATAATATGTATATAAAATCATCTCTCT GTTTTTTACTTGCATATATATCATTATAATTCTTTGTTACCTTATATTTTAAAAAATAAAATAAAAAAAATGAAATAAAA TAATTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200091: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12000912320333AA5500811178m3gmbPfHB3.1, G. Roman Reddy


Date: 15:2:22 on Sun 19 Nov 117.